Investigation of Curcumin Derivatives Binding to Duplex DNA
Poster Number
5
Introduction/Abstract
Turmeric is a flowering plant that belongs to the ginger herb family. Its roots have been used for thousands of years in Indian and East Asian culture to create spices, cosmetics, and herbal medicine. Curcumin [(1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione], is the most abundant (77%) curcuminoid and most active constituent of turmeric. It can undergo keto-enol tautomerization, but the keto form is predominated under acidic and neutral conditions providing more physiological relevance. It has been reported that curcumin has shown to have anti-inflammatory, antioxidant, cancer chemo-preventive, and chemotherapeutic properties2 and has been suggested to prevent and treat diseases like diabetes, asthma, Alzheimer’s, and cancer. This is due to its ability to bind signaling molecules, transcription factors, growth factors, pro-inflammatory enzymes, receptors, protein kinases, adhesion molecules, DNA, and RNA. Curcumin can bind to DNA via the minor grove using the thymine O2, the major groove using the guanine and adenine N7, and the phosphate backbone without inducing a conformational change. Preferentially, curcumin binds AT-rich regions. With this information, our group took an interest in investigating the binding of newly synthesized curcumin derivatives to DNA duplexes.
Purpose
Given the known effects of curcumin in the human body, our group took an interest in investigating the binding of newly synthesized curcumin derivatives to DNA duplexes. To further understand if the modification to the structure of curcumin could intensify or decrease its affinity on DNA.
Method
Synthesis of DNA oligonucleotides
DNA oligonucleotides were synthesized using a standard phosphoramidite protocol. Two DNA duplexes were prepared.
DNA 1: 5’-d(AAAAAAAAAAAAAAAAAAAAAA)
3’-d(TTTTTTTTTTTTTTTTTTTTTT)
DNA 2: 5’-d(CGTTCAGAGCCGGTTACGTCCTTCAT)
3’-d(GCAAGTCTCGGCCAATGCAGGAAGTA)
Preparing Stock/Working Solutions
All compounds were first dissolved in 500 μL of DMSO and further diluted to 1 mM solutions using DMSO.
Preparing UV Solutions
The thermal denaturation solutions were prepared by mixing 1 μM duplex DNA and 10 μM ligand in 10 mM sodium cacodylate buffer (pH 7.0) with 150 mM KCl. The mixture was heated at 95 ̊C for 5 min followed by slowly cooled down to room temperature, and then store at 4 ̊C overnight.
Thermal Denaturation Monitored by UV
Using UV Spectrometry, the melting point was determined of both pure DNA and the DNA-Curcumin complex. The UV absorbance at 260 nm was recorded as a function of temperature from 25-90 ̊C at a 0.5 ̊C/min scan rate. The melting temperature (Tm) was determined using the first derivative method, which is defined as the temperature at which 50% of the DNA is dissociated into random coils.
Results
All eighteen curcumin derivatives do not show observable thermal stabilization effect on both AT-tract and mixed duplex DNA. This suggests that these compounds could not bind to duplex DNA efficiently. Tethering additional moieties such as side chains may increase the binding affinity toward duplex DNA. The effect of these compounds on other DNA secondary structures such as triplex and G-quadruplex DNA will be determined in due course.
Significance
Our findings provide useful information for drug development. The structures of curcumin derivatives used in our study are not suitable for designing potent DNA binding ligands. Further modifications including additional side chains and functional groups are needed.
Location
DeRosa University Center
Format
Poster Presentation
Poster Session
Morning
Investigation of Curcumin Derivatives Binding to Duplex DNA
DeRosa University Center
Turmeric is a flowering plant that belongs to the ginger herb family. Its roots have been used for thousands of years in Indian and East Asian culture to create spices, cosmetics, and herbal medicine. Curcumin [(1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione], is the most abundant (77%) curcuminoid and most active constituent of turmeric. It can undergo keto-enol tautomerization, but the keto form is predominated under acidic and neutral conditions providing more physiological relevance. It has been reported that curcumin has shown to have anti-inflammatory, antioxidant, cancer chemo-preventive, and chemotherapeutic properties2 and has been suggested to prevent and treat diseases like diabetes, asthma, Alzheimer’s, and cancer. This is due to its ability to bind signaling molecules, transcription factors, growth factors, pro-inflammatory enzymes, receptors, protein kinases, adhesion molecules, DNA, and RNA. Curcumin can bind to DNA via the minor grove using the thymine O2, the major groove using the guanine and adenine N7, and the phosphate backbone without inducing a conformational change. Preferentially, curcumin binds AT-rich regions. With this information, our group took an interest in investigating the binding of newly synthesized curcumin derivatives to DNA duplexes.
